![]() |
cutseq |
It removes the sequence from the specified start to the end positions (inclusive) and returns the rest of the sequence in the output file.
To remove bases 10 to 12 from a database entry and write to the new sequence file 'gatta2.seq':
% cutseq tembl:paamir gatta2.seq -from=10 -to=12 Removes a specified section from a sequence. |
Go to the input files for this example
Go to the output files for this example
Example 2
To remove the first 20 bases from 'tembl:paamir' and write it to 'jsh.seq':
% cutseq tembl:paamir -from=1 -to=20 -out=jsh.seq Removes a specified section from a sequence. |
Go to the output files for this example
Example 3
If the default start and end positions are accepted, then all of the sequence is removed!
% cutseq tembl:paamir starta.seq -sbeg=-1000 -send=1290 Removes a specified section from a sequence. Start of region to delete [1168]: End of region to delete [1290]: |
Go to the output files for this example
Mandatory qualifiers: [-sequence] sequence Sequence USA -from integer This is the start position (inclusive) of the section of the sequence that you wish to remove. -to integer This is the end position (inclusive) of the section of the sequence that you wish to remove. [-outseq] seqout Output sequence USA Optional qualifiers: (none) Advanced qualifiers: (none) General qualifiers: -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose |
Mandatory qualifiers | Allowed values | Default | |
---|---|---|---|
[-sequence] (Parameter 1) |
Sequence USA | Readable sequence | Required |
-from | This is the start position (inclusive) of the section of the sequence that you wish to remove. | Any integer value | Start of sequence (0) |
-to | This is the end position (inclusive) of the section of the sequence that you wish to remove. | Any integer value | End of sequence (0) |
[-outseq] (Parameter 2) |
Output sequence USA | Writeable sequence | <sequence>.format |
Optional qualifiers | Allowed values | Default | |
(none) | |||
Advanced qualifiers | Allowed values | Default | |
(none) |
ID PAAMIR standard; DNA; PRO; 2167 BP. XX AC X13776; M43175; XX SV X13776.1 XX DT 19-APR-1989 (Rel. 19, Created) DT 17-FEB-1997 (Rel. 50, Last updated, Version 22) XX DE Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation XX KW aliphatic amidase regulator; amiC gene; amiR gene. XX OS Pseudomonas aeruginosa OC Bacteria; Proteobacteria; gamma subdivision; Pseudomonadaceae; Pseudomonas. XX RN [1] RP 1167-2167 RA Rice P.M.; RT ; RL Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases. RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG. XX RN [2] RP 1167-2167 RX MEDLINE; 89211409. RA Lowe N., Rice P.M., Drew R.E.; RT "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomonas RT aeruginosa"; RL FEBS Lett. 246:39-43(1989). XX RN [3] RP 1-1292 RX MEDLINE; 91317707. RA Wilson S., Drew R.; RT "Cloning and DNA seqence of amiC, a new gene regulating expression of the RT Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC RT product."; RL J. Bacteriol. 173:4914-4921(1991). XX RN [4] RP 1-2167 RA Rice P.M.; RT ; RL Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases. RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG. XX DR SWISS-PROT; P10932; AMIR_PSEAE. DR SWISS-PROT; P27017; AMIC_PSEAE. DR SWISS-PROT; Q51417; AMIS_PSEAE. [Part of this file has been deleted for brevity] FT phenotype" FT /replace="" FT /gene="amiC" FT misc_feature 1 FT /note="last base of an XhoI site" FT misc_feature 648..653 FT /note="end of 658bp XhoI fragment, deletion in pSW3 causes FT constitutive expression of amiE" FT conflict 1281 FT /replace="g" FT /citation=[3] XX SQ Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other; ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat 60 ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac 120 aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg 180 aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg 240 agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc 300 ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg 360 tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg 420 agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga 480 acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga 540 ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa 600 gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct 660 acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg 720 cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg 780 ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg 840 aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt 900 acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct 960 tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc 1020 tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt 1080 acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca 1140 gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc 1200 agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt 1260 ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg 1320 cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca 1380 gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt 1440 gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc 1500 gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc 1560 cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga 1620 tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa 1680 gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca 1740 ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct 1800 gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg 1860 aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt 1920 catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg 1980 gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct 2040 gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa 2100 ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt 2160 cctcgag 2167 // |
>PAAMIR X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation ggtaccgctcgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgatcta cctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcacagg agaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccgaaa ccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagc aactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggaccccg gcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccggggggtac ggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcgagc gcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccgaaca tcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctgattc gccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaagca accatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatctaca ttccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccaggcgc gcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcgcca tcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcgagg cggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgccttact tctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttcttcc cggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgctcg gccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgtacg acatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccacagcc gcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggcagt cgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggtccg ccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcgcga gttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgcagct gatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgtgcc ggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgcgct gctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccccgc ggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcgatgc ccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaagct gaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaaccaggc caaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacctgtc gcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctgggaaa cgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgtcat catgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctggtt gctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgctgag cgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaaggc cggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagttcct cgag |
>PAAMIR X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation tgctcgatcaccaccagccgggcgacgggaactgcacgatctacctggcgagcctggagc acgagcgggttcgcttcgtacggcgctgagcgacagtcacaggagaggaaacggatggga tcgcaccaggagcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaaccgcgagggc ggcgtcggcggtcgcccgatcgaaacgctgtcccaggaccccggcggcgacccggaccgc tatcggctgtgcgccgaggacttcattcgcaaccggggggtacggttcctcgtgggctgc tacatgtcgcacacgcgcaaggcggtgatgccggtggtcgagcgcgccgacgcgctgctc tgctacccgaccccctacgagggcttcgagtattcgccgaacatcgtctacggcggtccg gcgccgaaccagaacagtgcgccgctggcggcgtacctgattcgccactacggcgagcgg gtggtgttcatcggctcggactacatctatccgcgggaaagcaaccatgtgatgcgccac ctgtatcgccagcacggcggcacggtgctcgaggaaatctacattccgctgtatccctcc gacgacgacttgcagcgcgccgtcgagcgcatctaccaggcgcgcgccgacgtggtcttc tccaccgtggtgggcaccggcaccgccgagctgtatcgcgccatcgcccgtcgctacggc gacggcaggcggccgccgatcgccagcctgaccaccagcgaggcggaggtggcgaagatg gagagtgacgtggcagaggggcaggtggtggtcgcgccttacttctccagcatcgatacg cccgccagccgggccttcgtccaggcctgccatggtttcttcccggagaacgcgaccatc accgcctgggccgaggcggcctactggcagaccttgttgctcggccgcgccgcgcaggcc gcaggcaactggcgggtggaagacgtgcagcggcacctgtacgacatcgacatcgacgcg ccacaggggccggtccgggtggagcgccagaacaaccacagccgcctgtcttcgcgcatc gcggaaatcgatgcgcgcggcgtgttccaggtccgctggcagtcgcccgaaccgattcgc cccgacccttatgtcgtcgtgcataacctcgacgactggtccgccagcatgggcggggga ccgctcccatgagcgccaactcgctgctcggcagcctgcgcgagttgcaggtgctggtcc tcaacccgccgggggaggtcagcgacgccctggtcttgcagctgatccgcatcggttgtt cggtgcgccagtgctggccgccgccggaagccttcgacgtgccggtggacgtggtcttca ccagcattttccagaatggccaccacgacgagatcgctgcgctgctcgccgccgggactc cgcgcactaccctggtggcgctggtggagtacgaaagccccgcggtgctctcgcagatca tcgagctggagtgccacggcgtgatcacccagccgctcgatgcccaccgggtgctgcctg tgctggtatcggcgcggcgcatcagcgaggaaatggcgaagctgaagcagaagaccgagc agctccaggaccgcatcgccggccaggcccggatcaaccaggccaaggtgttgctgatgc agcgccatggctgggacgagcgcgaggcgcaccagcacctgtcgcgggaagcgatgaagc ggcgcgagccgatcctgaagatcgctcaggagttgctgggaaacgagccgtccgcctgag cgatccgggccgaccagaacaataacaagaggggtatcgtcatcatgctgggactggttc tgctgtacgttggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgcgtcgcgttct acctgatcttttccgcagcagccgggcagggctcgctgaaggccggagcgctgaccctgc tattcgcttttacctatctgtgggtggccgccaaccagttcctcgag |
>PAAMIR X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation |
Program name | Description |
---|---|
biosed | Replace or delete sequence sections |
degapseq | Removes gap characters from sequences |
descseq | Alter the name or description of a sequence |
entret | Reads and writes (returns) flatfile entries |
extractfeat | Extract features from a sequence |
extractseq | Extract regions from a sequence |
listor | Writes a list file of the logical OR of two sets of sequences |
maskfeat | Mask off features of a sequence |
maskseq | Mask off regions of a sequence |
newseq | Type in a short new sequence |
noreturn | Removes carriage return from ASCII files |
notseq | Excludes a set of sequences and writes out the remaining ones |
nthseq | Writes one sequence from a multiple set of sequences |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a sequence |
seqret | Reads and writes (returns) sequences |
seqretsplit | Reads and writes (returns) sequences in individual files |
skipseq | Reads and writes (returns) sequences, skipping the first few |
splitter | Split a sequence into (overlapping) smaller sequences |
trimest | Trim poly-A tails off EST sequences |
trimseq | Trim ambiguous bits off the ends of sequences |
union | Reads sequence fragments and builds one sequence |
vectorstrip | Strips out DNA between a pair of vector sequences |
yank | Reads a sequence range, appends the full USA to a list file |